str sequencing Search Results


90
Genetica Inc str sequencing
Str Sequencing, supplied by Genetica Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/str sequencing/product/Genetica Inc
Average 90 stars, based on 1 article reviews
str sequencing - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Eurofins str sequencing
Str Sequencing, supplied by Eurofins, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/str sequencing/product/Eurofins
Average 90 stars, based on 1 article reviews
str sequencing - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
SecuGen Corporation microsatellite sequencing amplification (short tandem repeat (str)-pcr profiling
Microsatellite Sequencing Amplification (Short Tandem Repeat (Str) Pcr Profiling, supplied by SecuGen Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/microsatellite sequencing amplification (short tandem repeat (str)-pcr profiling/product/SecuGen Corporation
Average 90 stars, based on 1 article reviews
microsatellite sequencing amplification (short tandem repeat (str)-pcr profiling - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
IDEXX str dna sequencing
Str Dna Sequencing, supplied by IDEXX, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/str dna sequencing/product/IDEXX
Average 90 stars, based on 1 article reviews
str dna sequencing - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Microsynth ag str sequencing
Str Sequencing, supplied by Microsynth ag, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/str sequencing/product/Microsynth ag
Average 90 stars, based on 1 article reviews
str sequencing - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Promega str sequencing
Str Sequencing, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/str sequencing/product/Promega
Average 90 stars, based on 1 article reviews
str sequencing - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
GenScript corporation 4.5-kb sequence fragment for str-1 promoter
4.5 Kb Sequence Fragment For Str 1 Promoter, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/4.5-kb sequence fragment for str-1 promoter/product/GenScript corporation
Average 90 stars, based on 1 article reviews
4.5-kb sequence fragment for str-1 promoter - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Sangon Biotech str-binding single-stranded dna (str1 aptamer sequence: 50- tagggaattcgtcgacggatccggggtctggtgttctgctttg ttctgtcgggtcgtctgcaggtcgacgcatgcgccg-30, 79-mer)
Str Binding Single Stranded Dna (Str1 Aptamer Sequence: 50 Tagggaattcgtcgacggatccggggtctggtgttctgctttg Ttctgtcgggtcgtctgcaggtcgacgcatgcgccg 30, 79 Mer), supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/str-binding single-stranded dna (str1 aptamer sequence: 50- tagggaattcgtcgacggatccggggtctggtgttctgctttg ttctgtcgggtcgtctgcaggtcgacgcatgcgccg-30, 79-mer)/product/Sangon Biotech
Average 90 stars, based on 1 article reviews
str-binding single-stranded dna (str1 aptamer sequence: 50- tagggaattcgtcgacggatccggggtctggtgttctgctttg ttctgtcgggtcgtctgcaggtcgacgcatgcgccg-30, 79-mer) - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Sangon Biotech str sequencing
Str Sequencing, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/str sequencing/product/Sangon Biotech
Average 90 stars, based on 1 article reviews
str sequencing - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Kurabo industries stearylated moiety that was covalently linked to the n-term of kala sequence (weklakalakalakhlakalakalka-nh2) (str-kala)
Stearylated Moiety That Was Covalently Linked To The N Term Of Kala Sequence (Weklakalakalakhlakalakalka Nh2) (Str Kala), supplied by Kurabo industries, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/stearylated moiety that was covalently linked to the n-term of kala sequence (weklakalakalakhlakalakalka-nh2) (str-kala)/product/Kurabo industries
Average 90 stars, based on 1 article reviews
stearylated moiety that was covalently linked to the n-term of kala sequence (weklakalakalakhlakalakalka-nh2) (str-kala) - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
KU Leuven y-str sequences
Y Str Sequences, supplied by KU Leuven, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/y-str sequences/product/KU Leuven
Average 90 stars, based on 1 article reviews
y-str sequences - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Institut Curie short tandem repeat (str) dna sequencing
Short Tandem Repeat (Str) Dna Sequencing, supplied by Institut Curie, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/short tandem repeat (str) dna sequencing/product/Institut Curie
Average 90 stars, based on 1 article reviews
short tandem repeat (str) dna sequencing - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

Image Search Results