90
|
Genetica Inc
str sequencing Str Sequencing, supplied by Genetica Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/str sequencing/product/Genetica Inc Average 90 stars, based on 1 article reviews
str sequencing - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Eurofins
str sequencing Str Sequencing, supplied by Eurofins, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/str sequencing/product/Eurofins Average 90 stars, based on 1 article reviews
str sequencing - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
SecuGen Corporation
microsatellite sequencing amplification (short tandem repeat (str)-pcr profiling Microsatellite Sequencing Amplification (Short Tandem Repeat (Str) Pcr Profiling, supplied by SecuGen Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/microsatellite sequencing amplification (short tandem repeat (str)-pcr profiling/product/SecuGen Corporation Average 90 stars, based on 1 article reviews
microsatellite sequencing amplification (short tandem repeat (str)-pcr profiling - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
IDEXX
str dna sequencing Str Dna Sequencing, supplied by IDEXX, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/str dna sequencing/product/IDEXX Average 90 stars, based on 1 article reviews
str dna sequencing - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Microsynth ag
str sequencing Str Sequencing, supplied by Microsynth ag, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/str sequencing/product/Microsynth ag Average 90 stars, based on 1 article reviews
str sequencing - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Promega
str sequencing Str Sequencing, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/str sequencing/product/Promega Average 90 stars, based on 1 article reviews
str sequencing - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
GenScript corporation
4.5-kb sequence fragment for str-1 promoter 4.5 Kb Sequence Fragment For Str 1 Promoter, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/4.5-kb sequence fragment for str-1 promoter/product/GenScript corporation Average 90 stars, based on 1 article reviews
4.5-kb sequence fragment for str-1 promoter - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Sangon Biotech
str-binding single-stranded dna (str1 aptamer sequence: 50- tagggaattcgtcgacggatccggggtctggtgttctgctttg ttctgtcgggtcgtctgcaggtcgacgcatgcgccg-30, 79-mer) Str Binding Single Stranded Dna (Str1 Aptamer Sequence: 50 Tagggaattcgtcgacggatccggggtctggtgttctgctttg Ttctgtcgggtcgtctgcaggtcgacgcatgcgccg 30, 79 Mer), supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/str-binding single-stranded dna (str1 aptamer sequence: 50- tagggaattcgtcgacggatccggggtctggtgttctgctttg ttctgtcgggtcgtctgcaggtcgacgcatgcgccg-30, 79-mer)/product/Sangon Biotech Average 90 stars, based on 1 article reviews
str-binding single-stranded dna (str1 aptamer sequence: 50- tagggaattcgtcgacggatccggggtctggtgttctgctttg ttctgtcgggtcgtctgcaggtcgacgcatgcgccg-30, 79-mer) - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Sangon Biotech
str sequencing Str Sequencing, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/str sequencing/product/Sangon Biotech Average 90 stars, based on 1 article reviews
str sequencing - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Kurabo industries
stearylated moiety that was covalently linked to the n-term of kala sequence (weklakalakalakhlakalakalka-nh2) (str-kala) Stearylated Moiety That Was Covalently Linked To The N Term Of Kala Sequence (Weklakalakalakhlakalakalka Nh2) (Str Kala), supplied by Kurabo industries, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/stearylated moiety that was covalently linked to the n-term of kala sequence (weklakalakalakhlakalakalka-nh2) (str-kala)/product/Kurabo industries Average 90 stars, based on 1 article reviews
stearylated moiety that was covalently linked to the n-term of kala sequence (weklakalakalakhlakalakalka-nh2) (str-kala) - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
KU Leuven
y-str sequences Y Str Sequences, supplied by KU Leuven, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/y-str sequences/product/KU Leuven Average 90 stars, based on 1 article reviews
y-str sequences - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Institut Curie
short tandem repeat (str) dna sequencing Short Tandem Repeat (Str) Dna Sequencing, supplied by Institut Curie, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/short tandem repeat (str) dna sequencing/product/Institut Curie Average 90 stars, based on 1 article reviews
short tandem repeat (str) dna sequencing - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |